Genotyping of Platelet Alloantigens by DNA Sequencing in Pakistani Population

Inam Ullah1Abida Arshad2Usman Waheed3Noore Saba4Zahida Qasim5Muhammad Arshad6

1PhD Scholar, Department of Biological Sciences, International Islamic University, Islamabad

2Associate Professor, Department of Zoology, PMAS Arid Agriculture University, Rawalpindi

3Department of Pathology and Transfusion Medicine, Shaheed Zulfiqar Ali Bhutto Medical University, Islamabad

4Consultant Haematologist, Peshawar Regional Blood Centre, Department of Health, Khyber Pakhtunkhwa

5Consultant Haematologist, Mirpur Regional Blood Centre, Department of Pathology, Divisional Headquarters Teaching Hospital, Mirpur, AJK

6Associate Professor, Department of Biological Sciences, International Islamic University, Islamabad

Objective To study the prevalence in a particular ethnic group, genomic DNA is used to genotype HPAs. Detection of these polymorphisms is imperative to identify the risk of alloimmunization and the provision of HPAs. Current study was planned to determine the frequency of HPAs in the Pakistani population of blood donors.
Methodology:Genomic DNA was extracted from blood samples of 300 randomly selected platelet donors from five major cities of Pakistan (Islamabad, Peshawar, Karachi, Quetta, and Mirpur). This study was approved by the ethical committee of Shaheed Zulfiqar Ali Bhutto Medical University, Islamabad, Pakistan. Prior informed consent was taken from all the participants. Sequence-specific primers for platelets glycoprotein genes were designed using Primer 3 online software. The distinct targets were amplified through PCR. Amplified PCR products were eluted from the gel after electrophoresed, purified and sequenced. All the sequences and data obtained were analyzed through SPSS version 25.
Results:Genotyping of samples showed that among the subjected HPA systems, HPA-1, HPA-5, HPA-7w, HPA-19w, and HPA-21w systems were found to have both a and b alleles in the Pakistani population while only aa genotype was found in HPA-4, HPA-6w, HPA-8w, HPA-10w, HPA-11w, HPA-16w, and HPA-23w. The frequency of HPA-1a was 0.9333 and HPA-1b was 0.0666, HPA-5a was 0.8033 and HPA-5b was 0.1966, HPA-7wa was 0.98 and HPA-7wb was 0.02, HPA-19wa was 0.95 and HPA-19wb was 0.05 and HPA-21wa was 0.9866 and HPA-21wb was 0.0133. Among the analyzed HPAs, the mismatch probability was higher in HPA-5 while it was lower in HPA-21w.
Conclusion: HPA-4b, HPA-6b, HPA- 8b, HPA-10b, HPA-11b, HPA-16b and HPA-23b were absent. No homozygosity was found in the remaining genotyped HPAs. Our study suggests that it is necessary to establish HPA screening sites in blood banks to have HPA typed donor registry providing compatible therapeutic platelets to all unimmunized patients. Our data will be useful to understand and better treat the alloimmune-mediated platelet disorders.
Key words:Alloantigens, Genotyping, Sequencing, Platelets, Platelet alloantigens

Platelets are 3-5μm, anucleated cell fragments in blood and critical for hemostasis.1 Over the last five decades, the transfusion of platelet concentrates is being regularly used for the treatment of thrombocytopenic patients, reducing the incidence and severity of bleeding disorders.2 The human platelet antigens (HPAs) result from single nucleotide polymorphisms (SNPs) in the genes that encode glycoprotein,3 expressed on platelet surface membranes, frequently on GPIIb/IIIa.4 In addition to the HPA, the platelet surface membrane comprises of other antigenic molecules namely ABO blood group antigens,5 human leukocyte antigens (HLA),6 and the Naka antigen present on CD36.7
HPA polymorphism results in the development of human platelet antibodies following alloimmunization,8 leading to the destruction of platelets.9 These alloantibodies develop in response to exposure to the alloantigens after blood transfusion and during pregnancy or transplantation. This may result in platelet disorders including neonatal alloimmune thrombocytopenia (NAIT), posttransfusion purpura (PTP), and refractoriness to platelet transfusion.
In NAIT, pregnant women become immunized to alloantigens of fetus platelets, resulting in thrombocytopenia in the infant.10 The PTP is an infrequently reported adverse reaction of blood transfusion characterized by severe thrombocytopenia within two weeks of transfusion.11,12 Refractoriness to platelets, on the other hand, occurs when the patient’s circulating platelet levels regularly fail to rise after transfusion of an adequate dose of platelets.13 Until now, 41 human platelet alloantigens have been identified14 on six platelet glycoprotein (GP) complexes which are functionally significant; GPIIb, GPIIIa, GPIba, GPIbb, GPIa and CD109.15 The HPA with a higher frequency is labeled as “a” while with low frequency is labeled as “b”. A word “w” attribution is added after the name of antigen if there is no reported alloantibody against antithetical antigen.5 The genotyping for HPA is required to identify the risk of alloimmunization and the provision of HPA-matched platelets for patients with alloimmune-mediated platelet disorders. HPA typing was formerly performed by serologic techniques.16 The current methods are based on genomic DNA, such as PCR sequence-based typing,17 PCR sequence-specific primers,18 restriction fragment length polymorphism‐PCR),19 real-time PCR,20 BeadChip Microarray Technology,21 matrix-assisted laser ionization or desorption time of flight-mass-spectrometry.22,23 The platelet antigen frequency is different among populations around the globe. Most of the existing data have been reported from North American and Western European regions. However, the incidence of HPA in other regions is still not studied extensively. In particular, data among Pakistani population, are still insufficient and so far, only one study has been published.24 This current study was performed to determine the frequency of human platelet antigens (HPA) in Pakistani blood donors to be able to provide HPA-matched platelets for patients with immune platelet disorders.

This cross-sectional study was performed from October 2019 to February 2020, at the Department of Pathology and Transfusion Medicine, Pakistan Institute of Medical Sciences (PIMS), Shaheed Zulfiqar Ali Bhutto Medical University (SZABMU), Islamabad, Pakistan. A total of 300 regular healthy blood donors were recruited in this study. These donors were randomly selected following careful selection criteria,25 from five major cities including Islamabad (PIMS/SZABMU), Peshawar (Regional Blood Centre), Karachi (Regional Blood Centre), Quetta (Regional Blood Centre), and Mirpur (Department of Pathology and Transfusion Medicine, Divisional Headquarters Teaching Hospital). From each centre, blood samples were collected in EDTA tubes and transported to the study site, following standard protocols of cold chain maintenance. Written informed consent was obtained from all study participants. This study was approved by the ethical committee of the SZABMU, Islamabad, Pakistan.
Laboratory analyses
DNA extraction

Genomic DNA from the whole blood of all samples was extracted using the inorganic method.26 The DNA concentration was maintained to 20–50 ng/µl. The extracted DNA was stored at 4ºC for further use. To determine the quality of DNA, the extracted DNA was detected through UV light after performing agarose gel electrophoresis. 2µL DNA was mixed with 1µL bromophenol dye and was loaded onto 1 percent agarose gel. 0.5-gram agarose was dissolved in 50 ml of 0.5x TBE buffer and was placed in a microwave oven until it started boiling. It was then placed at room temperature for cooling. 2 µL ethidium bromide was added and was mixed well. It was poured in gel tray with comb placed in it and placed for solidification at room temperature. After 20 – 30 minutes, comb was removed carefully, and the gel was ready with wells for loading DNA. 2 µL DNA was dissolved with 1 µL bromophenol dye and then each sample of extracted DNA was loaded separately in wells. Electrophoresis was performed for 30 minutes at 90 volts/cm (45 mA). The DNA was then visualized under UV lights by performing gel documentation assay. Designing sequence-specific primers HPA polymorphism of nucleotide sequences was obtained from the HPA Immuno Polymorphism Database.27 Sequence-specific primers were designed (Table 1) according to HPA nucleotide polymorphism and sequence obtained of GP1BA, ITGB3, ITGA2, ITGA2B, CD109 and GP1BB gens in the NCBI GenBank Database using Primer 3 online software.28 A pair of primers was used to amplify those HPA nucleotide polymorphisms which are located nearer to each other in the same gene. Different primers were designed for different HPA systems. All the designed pairs of primers had a different range of amplification product lengths. The location of primer attachment to the complementary sequence was kept 50 base pairs away from the HPA system polymorphism site.

Table I: Details of primers used for HPA

Name

Primer

Sequence (5'->3')

Tm (℃)

Length Amplicon (bp)

Final concentration

(mol/l)

HPA-1 and HPA-10w

Forward

TGCTCCAATGTACGGGGTAA

58.72

424

0.5

Reverse

TCCCACCCCATTTCCATTCTG

59.99

HPA-5

Forward

AGACGTGCTCTTGGTAGGTG

59.40

231

0.5

Reverse

TGGGGACATCCTCAAAAATGA

57.18

HPA-6w and HPA-7w

Forward

CTGGGCCCAACTGTGTCTAA

59.60

529

0.5

Reverse

GCAGGTATATGAGGGGGTGTG

59.93

HPA-4, HPA-16w and HPA-19w

Forward

GGTGGAGGATTACCCTGTGG

59.45

239

0.5

Reverse

CGTCTGGAGGAGGGACTTAC

58.90

HPA-8w, HPA-11w, HPA-21w and HPA-23w

Forward

AGCTGGACTGGGATACGCTT

60.98

254

0.5

Reverse

ACAGGTGGGAGTTGGATAGGT

60.20


Table II: PCR conditions for HPA-1, -5, -6,-7,-9,-10,-11,-21 and 23

HPA

Initial Denaturation

Denaturation

Annealing

Extension

Final Extension

HPA-1

and HPA-10w

Temp (℃ )

95

95

58

72

72

Time (Sec)

300

60

60

60

600

Repeats

35

HPA-5

Temp (℃ )

95

95

59

72

72

Time (Sec)

180

30

30

60

600

Repeats

35

HPA-6w and HPA-7w

Temp (℃ )

95

95

61

72

72

Time (Sec)

180

30

30

60

600

Repeats

35

HPA-8w, HAP-11w, HPA-21w and

HPA-23w

Temp (℃ )

95

95

60

72

72

Time (Sec)

180

30

30

60

600

Repeats

35


Amplification of required region using Polymerase Chain Reaction (PCR)
The required amplicon was amplified through PCR using the designed sequence-specific primers. Positive and negative control PCR reactions were also conducted. For this purpose, PCR tubes were used. All the reactions were performed in T100TM Thermal Cycler (Bio-Rad). Mixture for each PCR was made by adding 25 µL master mix (Thermo Genotyping of amplicon (Thermo Scientific), 5 µL forward primer, 5 µL reverse primer, and 5 µL DNA sample. The final volume was set to 50 µL by adding 10 µL PCR water. All these were properly mixed. Different conditions were set to carry out PCR for each pair of primers. Normal PCR was carried out for all pairs of primers (Table 2) except designed for HPA-4, HPA-16w, and HPA-19w, which were amplified through touch-down PCR (Table III)
Amplicons were purified and were sent for genotyping to Macrogen Inc, Korea. After genotyping, all the sequences were analyzed and then blasted with standard sequences of HPA polymorphism reported to Immuno-Polymorphism Database.27 Statistical analyses Statistical analyses were carried out using SPSS version 25.0 (IBM corporation, USA). Tests for Hardy-Weinberg equilibrium in the population were performed by x2 test. Chi-square test was used to calculate expected and observed. P values were assigned statistically significant which were less than 0.05.

Amplicon confirmation All the PCR products were confirmed by performing gel electrophoresis. Samples were run with a DNA ladder. All the PCR products were randomly loaded to confirm their molecular weight according to the specifically designed primers for PCR. The DNA ladder used was of 3000, 2000, 1500, 1200, 1000, 900, 800, 700, 600, 500, 400, 300, 200 and 100 from top to bottom respectively. All PCR products had durable and exact single bands (Fig 1).

HPAs are expressed on platelets and also other cells such as monocytes and endothelial cells. Human platelet antigens (HPAs) play a critical role in numerous immune platelet disorders such as NAIT, PTP, and refractoriness. About 10% to 20% of NAIT patients have postnatal intercranial hemorrhage (ICH) with a fatality of 5%. Although patients may have internal organs bleeding, but ICH is the feared cause of death. ICH may have a mortality rate of up to 48%.29 The reoccurrence of NAIT among consequent siblings having positive platelets antigens is about to 100%.30 According to National Blood Collection and Utilization Survey (NBCUS), in 2015, 305 cases of PTP were confirmed in the United States. About 30% of PTP patients have major hemorrhage with 10% rate of mortality. Women having children with PTP may have an increased risk of NAIT during their following pregnancy.31 Clinical studies suggest that 27% to 34% of platelets transfusion have unsatisfactory responses.32
The knowledge of antigen frequencies in a population is essential for the medical management of patients with immune-mediated platelet disorders. The pattern of HPA frequency varies in different countries globally. Partial data on HPA frequency in the Pakistani population exist. The current study assessed the gene frequency of HPA for 300 blood donors from five large blood centers in the country. Pakistani people belong to different origins and cultures. Although there are many ethnic groups living in Pakistan, the most known are Panjabis, Pashtuns, Sindhis, Balochis, and Kashmiris. The current study focused on Punjabis, Pashtuns, and Kashmiris.
In Pakistan, the rate of consanguineous marriages is very high.29-31 Consanguineous marriages cause to have greater chances of many abnormalities which also affect platelets glycoprotein. It may also cause the production of isoantibodies.32 So platelets glycoprotein is also affected due to consanguineous marriages. DNA-based techniques have become a standard after the discovery that the determination of molecular HPA type is due to the substitution of the amino acid at a specific location. Alleles of HPA systems are different on the basis of SNP except for HPA-14w which is due to the deletion of AAG nucleotide. In this study, we analyzed the frequency distribution of HPA system including, HPA-(1,4,5,6w,7w,8w,10w,11w,16w,19w,21w,23w) using PCR- Sequence-Based Typing Method. All the SNP containing regions of subjected HPA systems were amplified using SSP. Primers were designed to be away more than 50 nucleotides from the site of SNP. Targeted regions were amplified, purified and sequenced. HPA mismatch increases the likelihood of alloimmunization during pregnancy, allogeneic stem cell transplantation and platelets transfusion. A study from Indonesia revealed that alloimmunization against HPA-1, 2 and 6w is uncommon; whereas HPA-1 is the prevalent alloantigen in caucasians.33 Our study has reported mismatch probability in HPA-1, 5, 7w, 19w and 21w, which can be a risk for alloimmunization. A study performed in Germany on the Turkish and Caucasian populations, compared the HPA between both groups and observed no statistical differences.34 Similarly, a study from Brazil showed no statistical difference between the reported alleles frequencies of different ethnic groups.35 Two more studies compared blood donors and platelet donors of southern Brazil and found statistical significance for HPA-1, HPA-2, HPA-5 and HPA-15.36,37 A study from Algeria have similarity in alleles frequencies of HPA-4 and 5, but had difference of HPA-1, when compared to our study.38 The allele frequencies of HPA-1, 4, 8w, 10w, 11w, 16w and 21w in our study were similar to the reported frequencies in Chinese population.39 There is great difference of HPA-5 genotyping distribution among the population of Pakistan and Iran.40
An earlier study from Pakistan24 reported a Hardy-Weinberg equilibrium deviation towards alleles HPA-3b and HPA-5b, due to increased consanguinity rates. In our study, aa genotypes were observed in all HPA systems except HPA-1, -5,-7w,-19w and HPA-21w. When compared to a previous study,24 there was a significant difference (P < 0.05) in HPA-1a. No significant difference (P < 0.05) was seen between the reported and observed HPA-4a and HPA-5a in the Pakistani population. HPA gene frequencies in the population of different countries

This is the first study to genotype HPA systems in blood donors from the five major cities of Pakistan. Our study has reported that HPA-1, -5, -7w, -19w, and HPA-21w systems were found to have both a and b alleles in the Pakistani population while only aa genotype was found in HPA-4, -6w, -8w, -10w, -11w, -16w, and -23w. The study will be important to provide information to prevent and treat alloimmunization triggered by HPA. It will also help to improve blood component therapy. It is necessary to establish HPA screening sites in blood banks to have HPA typed donor registry providing compatible therapeutic platelets to all unimmunized patients. Future research can study possible feasible and effective methods of HPA screening and also provide a guideline for potential HPA screening during pregnancy.

We wish to thank all blood bank staff of Pakistan Institute of Medical Sciences, Shaheed Zulfiqar Ali Bhutto Medical University, Islamabad, Pakistan.

  1. Schiffer CA, Bohlke K, Delaney M, Hume H, Magdalinski AJ, McCullough JJ, et al. Platelet Transfusion for Patients with Cancer: American Society of Clinical Oncology Clinical Practice Guideline Update. J Clin Oncol. 2018;36(3):283-299. doi: 10.1200/JCO.2017.76.1734.
  2. van der Meijden PEJ, Heemskerk JWM. Platelet biology and functions: new concepts and clinical perspectives. Nat Rev Cardiol. 2019;16(3):166-179. doi: 10.1038/s41569-018-0110-0.
  3. Regan F, Lees CC, Jones B, Nicolaides KH, Wimalasundera RC, Mijovic A; Royal College of Obstetricians and Gynaecologists. Prenatal Management of Pregnancies at Risk of Fetal Neonatal Alloimmune Thrombocytopenia (FNAIT): Scientific Impact Paper No. 61. BJOG. 2019;126(10):e173-e185. doi: 10.1111/1471-0528.15642.
  4. O'Donghaile D, Jenkins PV, McGrath RT, Preston L, Field SP, Ward SE, O'Sullivan JM, O'Donnell JS. Expresser phenotype determines ABO(H) blood group antigen loading on platelets and von Willebrand factor. Sci Rep. 2020;10(1):18366. doi: 10.1038/s41598-020-75462-2.
  5. Song X, Qi J, Fang K, Li X, Han Y. A meta-analysis of risk factors associated with platelet transfusion refractoriness. Int J Hematol. 2023;117(6):863-875. doi: 10.1007/s12185-023-03557-3. Kashiwagi H, Honda S, Take H, Mizutani H, Imai Y, Furubayashi T, Tomiyama Y, Kurata Y, Yonezawa T. Presence of the entire coding region of GP IV mRNA in Nak(a)-negative platelets. Int J Hematol. 1993;57(2):153-61
  6. Jiang D, Panch SR. Evidence-Based Minireview: Strategies to manage a severely HLA-alloimmunized patient with refractory thrombocytopenia. Hematology Am Soc Hematol Educ Program. 2022;2022(1):437-441. doi: 10.1182/hematology.2022000416.
  7. Saris A, Pavenski K. Human Leukocyte Antigen Alloimmunization and Alloimmune Platelet Refractoriness. Transfus Med Rev. 2020;34(4):250-257. doi: 10.1016/j.tmrv.2020.09.010. Jovanovic Srzentic S, Lilic M, Vavic N, Radovic I, Djilas I. Genotyping of Eight Human Platelet Antigen Systems in Serbian Blood Donors: Foundation for Platelet Apheresis Registry. Transfus Med Hemother. 2021;48(4):228-233. doi: 10.1159/000514487.
  8. Bertrand G, Conti F. Genotyping of Human Platelet Antigens by BeadChip Microarray Technology. Methods Mol Biol. 2015;1310:149-65. doi: 10.1007/978-1-4939-2690-9_13. Kim TY, Yu H, Phan MT, Jang JH, Cho D. Application of Blood Group Genotyping by Next-Generation Sequencing in Various Immunohaematology Cases. Transfus Med Hemother. 2021;49(2):88-96. doi: 10.1159/000517565.
  9. Garritsen HS, Fan AX, Bosse N, Hannig H, Kelsch R, Kroll H, Holzgreve W, Zhong XY. Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry for genotyping of human platelet-specific antigens. Transfusion. 2009;49(2):252-8. doi: 10.1111/j.1537-2995.2008.01953.x. Bhatti FA, Uddin M, Ahmed A, Bugert P. Human platelet antigen polymorphisms (HPA-1, -2, -3, -4, -5 and -15) in major ethnic groups of Pakistan. Transfus Med. 2010;20(2):78-87. doi: 10.1111/j.1365-3148.2009.00982.x.
  10. Koshy L, Anju AL, Harikrishnan S, Kutty VR, Jissa VT, Kurikesu I, Jayachandran P, Jayakumaran Nair A, Gangaprasad A, Nair GM, Sudhakaran PR. Evaluating genomic DNA extraction methods from human whole blood using endpoint and real-time PCR assays. Mol Biol Rep. 2017;44(1):97-108. doi: 10.1007/s11033-016-4085-9. Immuno Polymorphism Database. Available from https://www.ebi.ac.uk/ipd/ accessed on June 30, 2022
  11. Rozen S, Skaletsky H. Primer3 on the WWW for general users and for biologist programmers. Methods Mol Biol. 2000;132:365-86. doi: 10.1385/1-59259-192-2:365. Bussel JB, Vander Haar EL, Berkowitz RL. New developments in fetal and neonatal alloimmune thrombocytopenia. Am J Obstet Gynecol. 2021;225(2):120-127. doi: 10.1016/j.ajog.2021.04.211.
  12. Prodger CF, Rampotas A, Estcourt LJ, Stanworth SJ, Murphy MF. Platelet transfusion: Alloimmunization and refractoriness. Semin Hematol. 2020;57(2):92-99. doi: 10.1053/j.seminhematol.2019.10.001. Darr A, Modell B. The frequency of consanguineous marriage among British Pakistanis. J Med Genet. 1988;25(3):186-90. doi: 10.1136/jmg.25.3.186
  13. Asmarinah, Dharma R, Ritchie NK, Rahayu S, Putricahya E, Santoso S. Human platelet-specific antigen frequencies in Indonesian population. Transfus Med. 2013;23(4):250-3. doi: 10.1111/tme.12039. Hauck-Dlimi B, Hammon K, Eckstein R, Ott S, Zimmermann R, Dengler T, Ringwald J. Human platelet antigen genotypes in Turkish and Caucasian blood donors in Germany. Tissue Antigens. 2012;80(3):214-8. doi: 10.1111/j.1399-0039.2012.01908.x.
  14. Kuniyoshi AM, Chiba AK, Vieira Filho JP, Castro BS, Bordin JO. HPA-9 and HPA-3 allelic frequencies in Brazilian blood donors and Amazon Indians. Transfus Med. 2010;20(5):354-5. doi: 10.1111/j.1365-3148.2010.01018.x.
  15. Brouk H, Halle L, Bertrand G, Neche FZ, Ouelaa H, Kaplan C. Human platelet antigen allele frequencies in different Algerian populations. Tissue Antigens. 2010;75(6):673-8. doi: 10.1111/j.1399-0039.2009.01429.x. Hong X, Chen S, Ying Y, Liu Y, Xu X, He J, Zhu F. Simultaneous genotyping of human platelet alloantigen-1 to 28bw systems by multiplex polymerase chain reaction sequence-based typing. Vox Sang. 2017;112(4):360-366. doi: 10.1111/vox.12507
  16. Kazemi MH, Malakootikhah F, Momeni-Varposhti Z, Falak R, Delbandi AA, Tajik N. Human platelet antigen 1-6, 9 and 15 in the Iranian population: An anthropological genetic analysis. Sci Rep. 2020;10(1):7442. doi: 10.1038/s41598-020-64469-4.